Review



superscript iii platinum one-step qrt-pcr-kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscript iii platinum one-step qrt-pcr-kit
    Superscript Iii Platinum One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pmc12272759-149-0-6
    Average 90 stars, based on 1 article reviews
    superscript iii platinum one-step qrt-pcr-kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Quantitative RT-PCR:

    Article Title: Immunisation of chickens with inactivated and/or infectious H9N2 avian influenza virus leads to differential immune B-cell repertoire development
    Article Snippet: .. For the qRT-PCR reactions, the Superscript III Platinum One-Step qRT-PCR Kit (Invitrogen) was used following the manufacturer’s instructions on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). .. The results were then analysed using the QuantStudio 5 software (Thermo Fisher Scientific).

    Article Title: Molecular Xenomonitoring (MX) allows real-time surveillance of West Nile and Usutu virus in mosquito populations
    Article Snippet: .. The SuperScript III Platinum One-Step qRT-PCR kit (ThermoFisher Scientific, Waltham, MA, USA) was used on a CFX96 thermal cycler, software version 3.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Article Title: Bluetongue Virus in the Iberian Lynx (Lynx pardinus), 2010–2022
    Article Snippet: .. All reactions were performed on the CFX96 Touch real-time PCR Detection System (Bio-Rad, Hercules, CA, USA), using the SuperScript III Platinum One-Step qRT-PCR Kit (ThermoFisher, MA, USA), according to manufacturer's protocol. ..

    Article Title: The quality of SIV-specific fCD8 T cells limits SIV RNA production in Tfh cells during antiretroviral therapy.
    Article Snippet: The attack and defense of infected cells and cytotoxic CD8 T cells occur in germinal centers in lymphoid tissue in chronic persistent HIV/SIV infection.. Latently infected cells, the therapeutic target of HIV infection, accumulate in follicular helper T (Tfh) cells in lymphoid tissue; the impact of HIV-specific follicular CD8 (fCD8) T cells in lymphoid tissue on the latently infected cells remains unknown.. We infected 15 cynomolgus macaques with SIVmac239 and examined the contribution of SIV-Gag-spe cific fCD8 T cells, defined by activation-induced markers (AIMs), to SIV-infected cells.

    Article Title: Etiological Spectrum of Acute Respiratory Infections in Bulgaria During the 2023-2024 Season and Genetic Diversity of Circulating Influenza Viruses.
    Article Snippet: .. Real-time RT-PCR was performed to subtype influenza A viruses and the influenza B genetic lineage was determined using the SuperScript III Platinum One-Step qRT-PCR kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), with specific primers and probes provided by IRR (Atlanta, GA, USA). .. Amplification was performed using a CFX96 thermal cycler (Bio-Rad Laboratories, Inc., Singapore), according to the protocol recommended by CDC (Atlanta, GA, USA) [14].

    Article Title: Prior infection with IBDV prolonged the shedding of a mallard H3N8 influenza A virus (IAV) challenge from the oropharyngeal cavity of some chickens and increased the number of amino acid substitutions in the IAV samples
    Article Snippet: Chloroform was added, and the resulting RNA was purified with an RNeasy kit (Qiagen). .. Reverse transcription quantitative polymerase chain rection (RTqPCR) was performed with a Superscript III Platinum One-Step qRT-PCR Kit (Life Technologies) using primers and a TaqMan probe specific to a conserved region of the influenza A matrix gene, following the method described by Spackman et al. (2002) ( ). ..

    Article Title: Molecular Xenomonitoring (MX) allows real-time surveillance of West Nile and Usutu virus in mosquito populations.
    Article Snippet: .. The SuperScript III Platinum One-Step qRT-PCR kit (ThermoFisher Scientific, Waltham, MA, USA) was used on a CFX96 thermal cycler, software version 3.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Article Title: Vaccine-induced T cell responses control Orthoflavivirus challenge infection without neutralizing antibodies in humans
    Article Snippet: Viral RNA was extracted from 200 μl of plasma samples using the Roche MagNA Pure 24 Total NA Isolation Kit, and the elution volume was 50 μl. .. The YF17D qPCR was conducted using the Superscript III Platinum One-Step qRT-PCR Kit (Invitrogen). .. Briefly, 5 μl of extracted RNA was added to 20 μl master mix containing 10 μM of YF17D-specific primers and probe as shown below: YF17D forward: GAACAGTGATCAGGAACCCTCTCT YF17D reverse: GGATGTTTGGTTCACAGTAAATGTG YFV-17D probe: 5′ HEX–CTACGTGTC/ZEN/TGGAGCCCGCAGCAAT–IABkFQ 3′ The human RNase P gene was amplified as an internal control for successful nucleic acid extraction using the same master mix containing 10 μM of RNase P specific primers and probe as shown below: RNase P forward: AGA TTT GGA CCT GCG AGC G RNase P reverse: GAG CGG CTG TCT CCA CAA GT RNase P probe: 5′ HEX–TTCTGACCT/ZEN/GAAGGCTCTGCGCG–IABkFQ 3′ Reverse transcription was performed at 50 °C for 15 min and then at 95 °C for 2 min, followed by 45 cycles of PCR amplification in a Roche LC96 RT-PCR System at an annealing temperature of 54 °C.

    Real-time Polymerase Chain Reaction:

    Article Title: Immunisation of chickens with inactivated and/or infectious H9N2 avian influenza virus leads to differential immune B-cell repertoire development
    Article Snippet: .. For the qRT-PCR reactions, the Superscript III Platinum One-Step qRT-PCR Kit (Invitrogen) was used following the manufacturer’s instructions on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). .. The results were then analysed using the QuantStudio 5 software (Thermo Fisher Scientific).

    Article Title: Bluetongue Virus in the Iberian Lynx (Lynx pardinus), 2010–2022
    Article Snippet: .. All reactions were performed on the CFX96 Touch real-time PCR Detection System (Bio-Rad, Hercules, CA, USA), using the SuperScript III Platinum One-Step qRT-PCR Kit (ThermoFisher, MA, USA), according to manufacturer's protocol. ..

    Article Title: Vaccine-induced T cell responses control Orthoflavivirus challenge infection without neutralizing antibodies in humans
    Article Snippet: Viral RNA was extracted from 200 μl of plasma samples using the Roche MagNA Pure 24 Total NA Isolation Kit, and the elution volume was 50 μl. .. The YF17D qPCR was conducted using the Superscript III Platinum One-Step qRT-PCR Kit (Invitrogen). .. Briefly, 5 μl of extracted RNA was added to 20 μl master mix containing 10 μM of YF17D-specific primers and probe as shown below: YF17D forward: GAACAGTGATCAGGAACCCTCTCT YF17D reverse: GGATGTTTGGTTCACAGTAAATGTG YFV-17D probe: 5′ HEX–CTACGTGTC/ZEN/TGGAGCCCGCAGCAAT–IABkFQ 3′ The human RNase P gene was amplified as an internal control for successful nucleic acid extraction using the same master mix containing 10 μM of RNase P specific primers and probe as shown below: RNase P forward: AGA TTT GGA CCT GCG AGC G RNase P reverse: GAG CGG CTG TCT CCA CAA GT RNase P probe: 5′ HEX–TTCTGACCT/ZEN/GAAGGCTCTGCGCG–IABkFQ 3′ Reverse transcription was performed at 50 °C for 15 min and then at 95 °C for 2 min, followed by 45 cycles of PCR amplification in a Roche LC96 RT-PCR System at an annealing temperature of 54 °C.

    Software:

    Article Title: Molecular Xenomonitoring (MX) allows real-time surveillance of West Nile and Usutu virus in mosquito populations
    Article Snippet: .. The SuperScript III Platinum One-Step qRT-PCR kit (ThermoFisher Scientific, Waltham, MA, USA) was used on a CFX96 thermal cycler, software version 3.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Article Title: Molecular Xenomonitoring (MX) allows real-time surveillance of West Nile and Usutu virus in mosquito populations.
    Article Snippet: .. The SuperScript III Platinum One-Step qRT-PCR kit (ThermoFisher Scientific, Waltham, MA, USA) was used on a CFX96 thermal cycler, software version 3.1 (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Amplification:

    Article Title: The quality of SIV-specific fCD8 T cells limits SIV RNA production in Tfh cells during antiretroviral therapy.
    Article Snippet: The attack and defense of infected cells and cytotoxic CD8 T cells occur in germinal centers in lymphoid tissue in chronic persistent HIV/SIV infection.. Latently infected cells, the therapeutic target of HIV infection, accumulate in follicular helper T (Tfh) cells in lymphoid tissue; the impact of HIV-specific follicular CD8 (fCD8) T cells in lymphoid tissue on the latently infected cells remains unknown.. We infected 15 cynomolgus macaques with SIVmac239 and examined the contribution of SIV-Gag-spe cific fCD8 T cells, defined by activation-induced markers (AIMs), to SIV-infected cells.

    Reverse Transcription:

    Article Title: Prior infection with IBDV prolonged the shedding of a mallard H3N8 influenza A virus (IAV) challenge from the oropharyngeal cavity of some chickens and increased the number of amino acid substitutions in the IAV samples
    Article Snippet: Chloroform was added, and the resulting RNA was purified with an RNeasy kit (Qiagen). .. Reverse transcription quantitative polymerase chain rection (RTqPCR) was performed with a Superscript III Platinum One-Step qRT-PCR Kit (Life Technologies) using primers and a TaqMan probe specific to a conserved region of the influenza A matrix gene, following the method described by Spackman et al. (2002) ( ). ..



    Similar Products

    90
    Thermo Fisher superscript iii platinum one-step qrt-pcr-kit
    Superscript Iii Platinum One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pmc12272759-149-0-6
    Average 90 stars, based on 1 article reviews
    superscript iii platinum one-step qrt-pcr-kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum one-step qrt-pcr kit
    Superscript Iii Platinum One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pmc11431934__24___0235___Techapp___s1-30-21-24
    Average 90 stars, based on 1 article reviews
    superscript iii platinum one-step qrt-pcr kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum sybr green one-step qrt-pcr kit
    Superscript Iii Platinum Sybr Green One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pm40561158-114-6-12
    Average 90 stars, based on 1 article reviews
    superscript iii platinum sybr green one-step qrt-pcr kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum one-step quantitative rt-pcr (qrt-pcr) kit
    Superscript Iii Platinum One Step Quantitative Rt Pcr (Qrt Pcr) Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pm40460152-70-6-14
    Average 90 stars, based on 1 article reviews
    superscript iii platinum one-step quantitative rt-pcr (qrt-pcr) kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum sybr green one-step qrt-pcr kit with rox
    Superscript Iii Platinum Sybr Green One Step Qrt Pcr Kit With Rox, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pm40304492-99-32-37
    Average 90 stars, based on 1 article reviews
    superscript iii platinum sybr green one-step qrt-pcr kit with rox - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iii platinum one-step kit for qrt-pcr with rox
    Superscript Iii Platinum One Step Kit For Qrt Pcr With Rox, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/high+capacity+cdna+reverse+transcription+kit/pm39994686-108-11-14
    Average 90 stars, based on 1 article reviews
    superscript iii platinum one-step kit for qrt-pcr with rox - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript™ iii platinum™ sybr™ green one-step qrt-pcr kit
    Superscript™ Iii Platinum™ Sybr™ Green One Step Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iii+platinum+one-step+qrt-pcr+kit/med_rxiv__2025__01__28__25321013-74-15-18
    Average 90 stars, based on 1 article reviews
    superscript™ iii platinum™ sybr™ green one-step qrt-pcr kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results